Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-182 URS00001CC379_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-182: Bta-mir-182 is a microRNA that has been found to have various effects on gene expression and cellular processes. It has been identified as a possible target for calpastatin, suggesting that elevated expression levels of bta-mir-182 could lead to decreased suppressive effects on calpain and increased meat tenderness [PMC7140828]. Up-regulation of bta-mir-182 has also been shown to down-regulate the anti-apoptotic BCL2 protein, promoting apoptosis and muscle proteolysis [PMC7140828]. Bta-mir-182, along with bta-mir-183 and bta-mir-338, has been found to regulate the expression levels of genes associated with various pathways [PMC7140828]. Additionally, bta-mir-182 may downregulate CAPN5, CASP2, and CASP9, inhibiting apoptosis [PMC7140828]. Bta-mir-182 is highly enriched in granulosa cells of preovulatory dominant follicles in cattle [PMC4438052]. It is also upregulated in theca cells, COC (cumulus-oocyte complexes), and follicular fluid of preovulatory dominant follicles compared to subordinate follicles counterparts [PMC4438052]. Bta-mir-182 is predicted to target the Forkhead box protein O1 (FOXO1) gene in these cells [PMC4438052]. In various studies, upregulation of bta-mir-182 has been associated with increased proteolysis and tenderness in meat [PMC6317189] as well as immune processes in mastitis caused by E. coli infection [PMC6107498] and testes development in yaks [PMC9940382]. It has also been shown to have regulatory relationships with specific genes and other microRNAs in different contexts such as endometrium differentiation [PMC9140398], circRNA regulation [PMC8946036], and udder parenchyma tissue infection [PMC7937231].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCAAUGGUAGAACUCACACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis ami-miR-182-5p
  2. Anolis carolinensis Aca-Mir-96-P2_5p (mature (guide))
  3. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-698200
  4. Callorhinchus milii Cmi-Mir-96-P2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-182
  6. Cavia porcellus cpo-miR-182-5p
  7. Cervus elaphus cel-miR-182
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-96-P2_5p (mature (guide))
  9. Chrysemys picta cpi-miR-182-5p
  10. Columba livia cli-miR-182-5p
  11. Danio rerio (zebrafish) Dre-Mir-96-P2a_5p (mature (guide))
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-182-5p
  13. Echinops telfairi Ete-Mir-96-P2_5p (mature (guide))
  14. Gadus morhua (Atlantic cod) Gmo-Mir-96-P2a_5p (mature (guide))
  15. Gallus gallus Gga-Mir-96-P2_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-96-P2_5p (mature (guide))
  17. Homo sapiens hsa-miR-182-5p
  18. Latimeria chalumnae Lch-Mir-96-P2_5p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-96-P2_5p (mature (guide))
  20. Macaca mulatta Mml-Mir-96-P2_5p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-96-P2_5p (mature (guide))
  22. Microcebus murinus mmr-miR-182
  23. Monodelphis domestica Mdo-Mir-96-P2_5p (mature (guide))
  24. Monopterus albus (swamp eel) Mal-Mir-96-P2a_5p (mature (guide))
  25. Mus musculus Mus_musculus piRNA piR-mmu-11029197
  26. Nomascus leucogenys nle-miR-182
  27. Ornithorhynchus anatinus Oan-Mir-96-P2_5p (mature (guide))
  28. Oryctolagus cuniculus (rabbit) ocu-miR-182-5p
  29. Otolemur garnettii oga-miR-182
  30. Pan troglodytes ptr-miR-182
  31. Petromyzon marinus (sea lamprey) pma-miR-182
  32. Python bivittatus (Burmese python) pbv-miR-182-5p
  33. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-4062115
  34. Scyliorhinus torazame Sto-Mir-96-P2_5p (mature (guide))
  35. Sphenodon punctatus (tuatara) Spt-Mir-96-P2_5p (mature (guide))
  36. Sus scrofa (pig) ssc-miR-182
  37. Taeniopygia guttata Tgu-Mir-96-P2_5p (mature (guide))
  38. Tetraodon nigroviridis Tni-Mir-96-P2a_5p (mature (guide))
  39. Xenopus laevis Xla-Mir-96-P2c_5p (mature (guide))
  40. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-96-P2_5p (mature (guide))
Publications