Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-182 URS00001CC379_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-182: ssc-mir-182 is a microRNA that has been studied in various contexts. It has been identified as one of the miRNAs involved in the regulation of protein expression in specific signaling pathways or miRNA-gene networks [PMC6354428]. In a study comparing different time points, ssc-mir-182 was found to be upregulated at 1W compared to baseline [PMC8367414]. It has also been shown to have higher expression levels in mpiPSCs compared to hpiPSCs [PMC4934789]. ssc-mir-182, along with other miRNAs such as ssc-miR-187, ssc-miR-136, ssc-miR-210, and ssc-miR-10b, participates in the regulation of the Neurotrophin signaling pathway by targeting corresponding genes [PMC4934789]. In another study, upregulation of ssc-mir-182 was found to be a contributing factor to PTEN down-regulation at 24 h post-infection [PMC4759598]. Furthermore, differential expression of ssc-mir-182 was observed at different time points post-infection with PRV Fa ΔgE/gI strain or Fa wild-type strain [PMC7329775]. These findings highlight the involvement and potential regulatory roles of ssc-mir-182 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCAAUGGUAGAACUCACACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis ami-miR-182-5p
  2. Anolis carolinensis Aca-Mir-96-P2_5p (mature (guide))
  3. Bos taurus (cattle) bta-miR-182
  4. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-698200
  5. Callorhinchus milii Cmi-Mir-96-P2_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-182
  7. Cavia porcellus cpo-miR-182-5p
  8. Cervus elaphus cel-miR-182
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-96-P2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-182-5p
  11. Columba livia cli-miR-182-5p
  12. Danio rerio (zebrafish) Dre-Mir-96-P2a_5p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-182-5p
  14. Echinops telfairi Ete-Mir-96-P2_5p (mature (guide))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-96-P2a_5p (mature (guide))
  16. Gallus gallus Gga-Mir-96-P2_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-96-P2_5p (mature (guide))
  18. Homo sapiens hsa-miR-182-5p
  19. Latimeria chalumnae Lch-Mir-96-P2_5p (mature (guide))
  20. Lepisosteus oculatus (spotted gar) Loc-Mir-96-P2_5p (mature (guide))
  21. Macaca mulatta Mml-Mir-96-P2_5p (mature (guide))
  22. Microcaecilia unicolor Mun-Mir-96-P2_5p (mature (guide))
  23. Microcebus murinus mmr-miR-182
  24. Monodelphis domestica Mdo-Mir-96-P2_5p (mature (guide))
  25. Monopterus albus (swamp eel) Mal-Mir-96-P2a_5p (mature (guide))
  26. Mus musculus Mus_musculus piRNA piR-mmu-11029197
  27. Nomascus leucogenys nle-miR-182
  28. Ornithorhynchus anatinus Oan-Mir-96-P2_5p (mature (guide))
  29. Oryctolagus cuniculus (rabbit) ocu-miR-182-5p
  30. Otolemur garnettii oga-miR-182
  31. Pan troglodytes ptr-miR-182
  32. Petromyzon marinus (sea lamprey) pma-miR-182
  33. Python bivittatus (Burmese python) pbv-miR-182-5p
  34. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-4062115
  35. Scyliorhinus torazame Sto-Mir-96-P2_5p (mature (guide))
  36. Sphenodon punctatus (tuatara) Spt-Mir-96-P2_5p (mature (guide))
  37. Taeniopygia guttata Tgu-Mir-96-P2_5p (mature (guide))
  38. Tetraodon nigroviridis Tni-Mir-96-P2a_5p (mature (guide))
  39. Xenopus laevis Xla-Mir-96-P2c_5p (mature (guide))
  40. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-96-P2_5p (mature (guide))
Publications