Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-182-5p URS00001CC379_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-182: Hsa-mir-182 is a microRNA that has been shown to play a role in androgen receptor pathway control [PMC5877771]. In a study investigating the overexpressed network, MIAT was identified as an important hub regulator that interacted with 14 differentially expressed microRNAs, including hsa-mir-182 [PMC6899321]. Specific miRNA sequence probes, including hsa-mir-182, were used in another study to analyze the expression of microRNAs in non-small-cell lung cancer patients [PMC9917592]. This study identified hsa-mir-182 as part of a five-microRNA signature that was found to be an independent prognostic factor for these patients [PMC7255356]. Additionally, hsa-mir-182 was among the ten most upregulated miRNAs in this study [PMC5588142]. In summary, hsa-mir-182 is a microRNA that has been implicated in androgen receptor pathway control and has been found to be differentially expressed in non-small-cell lung cancer patients. It has been identified as part of a prognostic signature and shown to be upregulated in these patients. These findings highlight the potential importance of hsa-mir-182 in cancer biology and prognosis.

mRNA interactions 11 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCAAUGGUAGAACUCACACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis ami-miR-182-5p
  2. Anolis carolinensis Aca-Mir-96-P2_5p (mature (guide))
  3. Bos taurus (cattle) bta-miR-182
  4. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-698200
  5. Callorhinchus milii Cmi-Mir-96-P2_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-182
  7. Cavia porcellus cpo-miR-182-5p
  8. Cervus elaphus cel-miR-182
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-96-P2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-182-5p
  11. Columba livia cli-miR-182-5p
  12. Danio rerio (zebrafish) Dre-Mir-96-P2a_5p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-182-5p
  14. Echinops telfairi Ete-Mir-96-P2_5p (mature (guide))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-96-P2a_5p (mature (guide))
  16. Gallus gallus Gga-Mir-96-P2_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-96-P2_5p (mature (guide))
  18. Latimeria chalumnae Lch-Mir-96-P2_5p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-96-P2_5p (mature (guide))
  20. Macaca mulatta Mml-Mir-96-P2_5p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-96-P2_5p (mature (guide))
  22. Microcebus murinus mmr-miR-182
  23. Monodelphis domestica Mdo-Mir-96-P2_5p (mature (guide))
  24. Monopterus albus (swamp eel) Mal-Mir-96-P2a_5p (mature (guide))
  25. Mus musculus Mus_musculus piRNA piR-mmu-11029197
  26. Nomascus leucogenys nle-miR-182
  27. Ornithorhynchus anatinus Oan-Mir-96-P2_5p (mature (guide))
  28. Oryctolagus cuniculus (rabbit) ocu-miR-182-5p
  29. Otolemur garnettii oga-miR-182
  30. Pan troglodytes ptr-miR-182
  31. Petromyzon marinus (sea lamprey) pma-miR-182
  32. Python bivittatus (Burmese python) pbv-miR-182-5p
  33. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-4062115
  34. Scyliorhinus torazame Sto-Mir-96-P2_5p (mature (guide))
  35. Sphenodon punctatus (tuatara) Spt-Mir-96-P2_5p (mature (guide))
  36. Sus scrofa (pig) ssc-miR-182
  37. Taeniopygia guttata Tgu-Mir-96-P2_5p (mature (guide))
  38. Tetraodon nigroviridis Tni-Mir-96-P2a_5p (mature (guide))
  39. Xenopus laevis Xla-Mir-96-P2c_5p (mature (guide))
  40. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-96-P2_5p (mature (guide))
Publications