v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-27a URS00000B6214_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCACAGUGGCUAAGUUCCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Ateles geoffroyi age-miR-27a
  2. Gorilla gorilla gorilla ggo-miR-27a (MIR27A)
  3. Gorilla gorilla ggo-miR-27a
  4. Lemur catta (Ring-tailed lemur) lca-miR-27a
  5. Macaca mulatta mml-miR-27a-3p
  6. Macaca nemestrina mne-miR-27a
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8319573
  8. Ophiophagus hannah oha-miR-27a-3p
  9. Pan paniscus (pygmy chimpanzee) ppa-miR-27a
  10. Pan troglodytes (chimpanzee) ptr-miR-27a
  11. Saguinus labiatus sla-miR-27a