Macaca mulatta (Rhesus monkey) mml-miR-27a-3p URS00000B6214_9544

• 22 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 11 other species
• 3946 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUCACAGUGGCUAAGUUCCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Ateles geoffroyi age-miR-27a
2. Gorilla gorilla gorilla ggo-miR-27a (MIR27A)
3. Gorilla gorilla ggo-miR-27a
4. Lemur catta (Ring-tailed lemur) lca-miR-27a
5. Macaca nemestrina mne-miR-27a
6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8319573
7. Ophiophagus hannah oha-miR-27a-3p
8. Pan paniscus (pygmy chimpanzee) ppa-miR-27a
9. Pan troglodytes (chimpanzee) ptr-miR-27a
10. Pongo pygmaeus ppy-miR-27a
11. Saguinus labiatus sla-miR-27a

Publications Download

• FASTA
• JSON