Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lemur catta (Ring-tailed lemur) lca-miR-27a URS00000B6214_9447

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Ateles geoffroyi age-miR-27a
  2. Gorilla gorilla gorilla ggo-miR-27a (MIR27A)
  3. Gorilla gorilla ggo-miR-27a
  4. Macaca mulatta mml-miR-27a-3p
  5. Macaca nemestrina mne-miR-27a
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8319573
  7. Ophiophagus hannah oha-miR-27a-3p
  8. Pan paniscus (pygmy chimpanzee) ppa-miR-27a
  9. Pan troglodytes (chimpanzee) ptr-miR-27a
  10. Pongo pygmaeus ppy-miR-27a
  11. Saguinus labiatus sla-miR-27a