Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tupaia chinensis (Chinese tree shrew) microRNA mir-205 secondary structure diagram

Tupaia chinensis (Chinese tree shrew) microRNA mir-205 URS000231D59F_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA mir-205
  2. Carlito syrichta (Philippine tarsier) microRNA mir-205
  3. Sapajus apella Cebus apella (Tufted capuchin) microRNA mir-205
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA mir-205
  5. Cercocebus atys (sooty mangabey) microRNA mir-205
  6. Chlorocebus sabaeus microRNA mir-205
  7. Chrysochloris asiatica microRNA mir-205
  8. Colobus angolensis palliatus microRNA mir-205
  9. Crocuta crocuta (spotted hyena) microRNA mir-205
  10. Diceros bicornis minor microRNA mir-205
  11. Gorilla gorilla gorilla microRNA mir-205
  12. Gorilla gorilla microRNA mir-205
  13. Homo sapiens microRNA mir-205
  14. Lagothrix lagotricha microRNA mir-205
  15. Macaca fascicularis (crab-eating macaque) microRNA mir-205
  16. Macaca mulatta microRNA mir-205
  17. Macaca nemestrina microRNA mir-205
  18. Mandrillus leucophaeus (drill) microRNA mir-205
  19. Microcebus murinus (gray mouse lemur) microRNA mir-205
  20. Nomascus leucogenys microRNA mir-205
  21. Oryctolagus cuniculus microRNA mir-205
  22. Otolemur garnettii (small-eared galago) microRNA mir-205
  23. Pan paniscus microRNA mir-205
  24. Pan troglodytes microRNA mir-205
  25. Papio anubis (Olive baboon) microRNA mir-205
  26. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA mir-205
  27. Pongo abelii (Sumatran orangutan) microRNA mir-205
  28. Pongo pygmaeus microRNA mir-205
  29. Prolemur simus (greater bamboo lemur) microRNA mir-205
  30. Propithecus coquereli (Coquerel's sifaka) microRNA mir-205
  31. Rhinopithecus bieti (Black snub-nosed monkey) microRNA mir-205
  32. Rhinopithecus roxellana (golden snub-nosed monkey) microRNA mir-205
  33. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA mir-205
  34. Suricata suricatta (meerkat) microRNA mir-205
  35. Theropithecus gelada (gelada baboon) microRNA mir-205
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications