v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) smooth muscle induced lncRNA, enhancer of proliferation (SMILR) URS000081211C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SMILR: SMILR, a long non-coding RNA (lncRNA), has been found to interact with CENPF mRNA and STAU1 in the Cell Cycle Network [PMC8592911]. It has been suggested that the increased levels of SMILR in the diseased vasculature may contribute to its release, but it is challenging to determine whether plasma SMILR is merely a by-product of increased intracellular levels or if it has functional activity in disease pathology [PMC4872641]. The combination of PDGF and IL1α has been shown to synergistically increase SMILR expression after 72 hours [PMC4872641]. SMILR may play a role in regulating HAS2 expression by acting as an enhancer or scaffold [PMC6949864]. Lentiviral overexpression of SMILR resulted in a 10-fold increase in intracellular SMILR RNA levels [PMC4872641]. Among differentially expressed lncRNAs, ENST00000533992, also known as smooth muscle-induced lncRNA (SMILR), has been identified as an important candidate for further investigation [PMC9201533].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAUUCUGUUUCGGUUGCAGUUCCAUUGUGUGGAGCCAGUACUACAACUUUUCCUCCUGCAUUCAUUUCUCUUCCUGCUGCCUUGUGAAGAAGGUGCCUUGCUUCCCCUUCACCUUCUACGGUGAUUGCAAGUUGCCUGAGGAUUCCCCAGCCAUGUGAAACUUUCACAGAGUUUGAGAGAAACUGUAUUCAAGUUGCUGAAACCAAGAAGCUACACUCACGAGUCUCACCUAAACUCGAAUCUGAUUUAGAUGACAUCAUCCUGGACUUUGAGUUGAUGAAACCUUGGAGGUCUUGGGAGUAAAGCAAGUGUGAUUUGCAUAUGAUGGAUAUGAAUUGUAAUGGCCAGAGCAUGGCUGUGGGAACCAAGACUGAAUUCCAUAAUUUACAUGGAUGUUUGGAAGGUGUCUGCAACUUAAUCUGUGUUCGUUUCUGAGAUGUUGGGCAACUCCUUCUUGGAAGAUGUGGUAAUGGUCUCUUCGAAAAGAAAAUAAUCAUCUGAGUUUUGGCCAAAAUAGUUGAUCGGAUUACCUAUGAAAAUGACUCUCACCCAACUACAAGAAUGUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications