v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5S ribosomal RNA from Thermus thermophilus (PDB 4V67, chain DB) secondary structure diagram

5S ribosomal RNA from Thermus thermophilus (PDB 4V67, chain DB) URS000080E212_274

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUCCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCCGAUGGUACUGGGCGGGCGACCGCCUGGGAGAGUAGGUCGGUGCGGGGGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Thermus thermophilus HB27 5S ribosomal RNA from Thermus thermophilus HB27 (PDB 4V63, chain DB)
  2. Thermus thermophilus HB8 5S ribosomal RNA from Thermus thermophilus HB8 (PDB 4W4G, chain YB)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications