Guanine riboswitch Guanine sequence

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Guanine riboswitch Guanine sequence URS000080DDA1_32644

67 nucleotides
1 database (RiboCentre)
Found in 4 other species
1. mRNA region
2. riboswitch

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Bacillus subtilis subsp. subtilis str. 168 5'-monophosphate wt guanine riboswitch from Bacillus subtilis subsp. subtilis str. 168 (PDB 5C7U, chain B)
synthetic construct Guanine sequence
unclassified sequences xpt-pbuX guanine Guanine sequence
Bacillus subtilis xpt-pbuX guanine riboswitch aptamer domain from Bacillus subtilis (PDB 4FE5, chain B)

Relationships

Molecular Relationships

2D structure

Loading 2D structure...