v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5'-monophosphate wt guanine riboswitch from Bacillus subtilis subsp. subtilis str. 168 (PDB 5C7U, chain B) secondary structure diagram

5'-monophosphate wt guanine riboswitch from Bacillus subtilis subsp. subtilis str. 168 (PDB 5C7U, chain B) URS000080DDA1_224308

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. unidentified Guanine riboswitch Guanine sequence
  2. synthetic construct Guanine sequence
  3. unclassified sequences xpt-pbuX guanine Guanine sequence
  4. Bacillus subtilis xpt-pbuX guanine riboswitch aptamer domain from Bacillus subtilis (PDB 4FE5, chain B)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...