v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sus scrofa (pig) microRNA ssc-mir-30c precursor (ssc-mir-30c-2) secondary structure diagram

Sus scrofa (pig) microRNA ssc-mir-30c precursor (ssc-mir-30c-2) URS00007E46D5_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACAGAUACUGUAAACAUCCUACACUCUCAGCUGUGGAAAGUAAGAAAGCUGGGAGAAGGCUGUUUACUCUCUCUGCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Canis lupus dingo microRNA 30c-2 (ENSCAFG00020009283.1)
  2. Canis lupus familiaris miRNA (ENSCAFG00000020557.2, ENSCAFG00030017668.1, ENSCAFG00040006547.1, ENSCAFG00845010251.1)
  3. Castor canadensis (American beaver) miRNA (ENSCCNG00000015761.1)
  4. Catagonus wagneri microRNA 30c-2 (ENSCWAG00000000682.1)
  5. Chlorocebus sabaeus microRNA 30c-2 (ENSCSAG00000027159.1)
  6. Felis catus (domestic cat) microRNA 30c-2 (ENSFCAG00000030273.4)
  7. Lynx canadensis microRNA 30c-2 (ENSLCNG00005009545.1)
  8. Macaca fascicularis microRNA 30c-2 (ENSMFAG00000006138.2)
  9. Macaca mulatta mml-mir-30c-2 (ENSMMUG00000027039.4, ENSMMUG00000054403.1)
  10. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023232.1)
  11. Neogale vison miRNA (ENSNVIG00000016952.1)
  12. Panthera leo (lion) microRNA 30c-2 (ENSPLOG00000010173.1)
  13. Papio anubis miRNA (ENSPANG00000001596.3)
  14. Piliocolobus tephrosceles miRNA (ENSPTEG00000013555.1)
  15. Pongo abelii miRNA (ENSPPYG00000020995.2)
  16. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000002837.1)
  17. Pteropus vampyrus miRNA (ENSPVAG00000025605.1)
  18. Suricata suricatta (meerkat) microRNA 30c-2 (ENSSSUG00005001314.1)
  19. Theropithecus gelada microRNA 30c-2 (ENSTGEG00000010512.1)
  20. Vulpes vulpes (red fox) miRNA (ENSVVUG00000009560.1)
  21. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015004136.1)
 2D structure Publications