Macaca mulatta (Rhesus monkey) microRNA mml-mir-7178 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) microRNA mml-mir-7178 precursor URS00007A601A_9544

63 nucleotides
3 databases (ENA, miRBase, RefSeq)
Found in 6 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAGGAGCUAUCAGAACUUAGUGAUCAAGUGAAGUCGUAGUUACUAAUUUCUGAUGCUCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Chlorocebus sabaeus (African green monkey) miRNA (ENSCSAG00000026170.1)
Mus musculus (mouse) predicted gene, 27616 (ENSMUSG00000098259.3)
Mus spretus predicted gene, 27616 (MGP_SPRETEiJ_G0007324.1)
Papio anubis (olive baboon) miRNA (ENSPANG00000045770.1)
Pongo abelii miRNA (ENSPPYG00000031601.1)
Theropithecus gelada (gelada) miRNA (ENSTGEG00000005153.1)