Theropithecus gelada (gelada) miRNA (ENSTGEG00000005153.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Theropithecus gelada (gelada) miRNA (ENSTGEG00000005153.1) URS00007A601A_9565

63 nucleotides
1 database (Ensembl)
Found in 6 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAGGAGCUAUCAGAACUUAGUGAUCAAGUGAAGUCGUAGUUACUAAUUUCUGAUGCUCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Chlorocebus sabaeus (African green monkey) miRNA (ENSCSAG00000026170.1)
Macaca mulatta (Rhesus monkey) microRNA mml-mir-7178 precursor
Mus musculus (mouse) predicted gene, 27616 (ENSMUSG00000098259.3)
Mus spretus predicted gene, 27616 (MGP_SPRETEiJ_G0007324.1)
Papio anubis (olive baboon) miRNA (ENSPANG00000045770.1)
Pongo abelii miRNA (ENSPPYG00000031601.1)