Pan paniscus (bonobo) microRNA 5571 (ENSPPAG00000000389.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 5571 (ENSPPAG00000000389.1) URS00007A3E72_9597

113 nucleotides
1 database (Ensembl)
Found in 2 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AUCUGACACAAAAUGUGAACCAAGCAAUUCUCAAAGGAGCCUCCCAGGAAAUUCACUUUAGGAAGUCCUAGGAGGCUCCUCUGAGAGUUGCUAAAACAAAACAUUGAGAGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Homo sapiens (human) microRNA hsa-mir-5571 precursor
Pan troglodytes (chimpanzee) microRNA 5571 (ENSPTRG00000048719.1)

Publications