Drosophila sechellia mir-1011 microRNA precursor family

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila sechellia mir-1011 microRNA precursor family URS000079C1D2_7238

54 nucleotides
1 database (Rfam)
Found in 2 other species
3 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGAGUUUUUGAGCCAGGAAUAUAGUUCUUAUUAUUGGUUCAAAUCGCUCGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Drosophila melanogaster microRNA dme-mir-1011 precursor
Drosophila simulans mir-1011 microRNA precursor family

2D structure

Publications