Automated summary: This pre miRNA sequence is 146 nucleotides long and is found in Solanum lycopersicum. Annotated by 3 databases (ENA, RefSeq, miRBase). Has a conserved secondary structure or a structured region. Solanum lycopersicum miR482d stem-loop (sly-MIR482d) sequence is a product of MIR482d precurso, MIR482d precursor, MIR482d, sly-MIR482d precursor genes. Found in the Solanum lycopersicum reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGAAAGGGAGGAGGGAUUUGGGAAUCUUUUGGAGUGGGUGGGAUGGAAAAAUAUUGUAUUUUUUUUUCUAACGGAAAAAAAGAUGAGAAUUGAGAUUUUUCCUAUUCCACCCAUGCCAAUGGCUUCCAGUCAUUUACUCCUUUUCC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.