v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) microRNA 4517 (ENSPPYG00000038078.1) URS000075EBD5_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGUAAAUAUGAUGAAACUCACAGCUGAGGAGCUUAGCAAGUAGCUAAGGCCAGAGCUUGUGUUUGGGUGGUGUGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Homo sapiens (human) microRNA hsa-mir-4517 precursor
  2. Pan paniscus microRNA 4517 (ENSPPAG00000009723.1)
  3. Pan troglodytes miRNA
 Publications