Pan paniscus (bonobo) microRNA 4517 (ENSPPAG00000009723.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 4517 (ENSPPAG00000009723.1) URS000075EBD5_9597

79 nucleotides
1 database (Ensembl)
Found in 3 other species
4 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AGGUAAAUAUGAUGAAACUCACAGCUGAGGAGCUUAGCAAGUAGCUAAGGCCAGAGCUUGUGUUUGGGUGGUGUGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Homo sapiens (human) microRNA hsa-mir-4517 precursor
Pan troglodytes miRNA
Pongo abelii microRNA 4517 (ENSPPYG00000038078.1)

Publications