Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-338 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-338 precursor URS000075E706_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR338: MIR338 is a microRNA that plays a role in the osteoblast lineage priming ability of bone marrow stromal cells, as revealed by single-cell transcriptomic analysis [PMC9898552]. The conditional knockdown of the MIR338 cluster in the preosteoblast lineage further confirmed its role in restoring this priming ability [PMC9898552]. In the context of hepatocellular carcinoma (HCC), a comprehensive search was conducted to determine the diagnostic value of miR-338-5p [PMC5783480]. The search included databases such as Gene Expression Omnibus (GEO), PubMed, Embase, Cochrane, Web of Science, Sinomed, Chinese VIP, Wanfang database, and China National Knowledge Infrastructure (CNKI) [PMC5783480]. The search strategy included terms related to miR-338 and HCC to identify relevant studies [PMC5783480]. This search was conducted until December 15, 2016 [PMC5783480]. The aim was to gather comprehensive data on the diagnostic value of miR-338-5p in HCC [PMC5783480].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCAACAAUAUCCUGGUGCUGAGUGAUGACUCAGGCGACUCCAGCAUCAGUGAUUUUGUUGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

2D structure Publications