Callithrix jacchus (white-tufted-ear marmoset) microRNA 6720 (ENSCJAG00000045827.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) microRNA 6720 (ENSCJAG00000045827.2) URS000075E43D_9483

98 nucleotides
1 database (Ensembl)
Found in 1 other species
3 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUGAGCGAGAGAUUGUGGCGCACCGAGUUCUUCCAGCCCUGGUAGGCGCCGCGGAAGAAGGGGAAGCGCGCCUGCAGGAACUGGUAGAUCUCGCUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens (human) microRNA hsa-mir-6720 precursor

Publications