v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2587 (LINC02587) URS000075E15D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02587: LINC02587 is a long non-coding RNA (lncRNA) that has been studied in various malignancies [PMC8430277]. In a study by Zhang et al., it was found that the expression level of LINC02587 was negatively correlated with prognosis [PMC8430277]. Another study by Zhang et al. identified LINC02587 as one of the survival-related lncRNAs in gastric cancer [PMC8430277]. In this study, elevated expression of LINC02587 was predicted to be a protective factor for head and neck squamous cell carcinoma (HNSCC) patients [PMC9465021]. Furthermore, LINC02587 has been identified as a lncRNA that has not been previously reported to have a potential relationship with malignancies, making it a potential candidate for further oncology studies [PMC9459339]. Additionally, LINC02587 has been included in an eight-lncRNA signature (GIRlncPS) for predicting prognosis in gastric cancer patients [PMC8339593]. Furthermore, the expression levels of H19, LINC02587, and other lncRNAs have been found to be useful as risk models for identifying suitable treatments and improving the treatment outcomes in patients with low-grade glioma (LGG) [PMC9633682]. Moreover, there is evidence suggesting that the expression levels of certain genes such as MEOX2 and GATA2 positively correlate with LINC02587 expression [PMC8777518]. In summary, LINC02587 is an lncRNA that has been implicated in various malignancies and shows potential as a prognostic marker and therapeutic target. Further research is needed to fully understand its role in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACUAAAUCUUUUGUUCACCAGCUGCUCAGCUUUUCAGUCUGGGUCUGAGCUGAAACCUGCUGCAAGUCUGACGGUACCAAAUUACAUAUAUAUCUGUCAAAAUGAUGUAGGACCUAAAGUCUCUCUGUAAGUUGAUCCUUUUGACCCCAUGAUUAGGAGCUUCACAAUGUGGUACCACACCUGGAAACCUCCAGAACAAGAUCUCAAGGAAACACAGGAAAUUCCUGAAACAGCAAAACCCCCUAUGUGAAGACGUCUGUUAUUCCUUUGUGUAUCAGGAGCAUCACUGUUAAUUAACUGUUGAUACACUUAAAACAGCUUGGUUGGCAAUGUCCUUUUUGAAUAAAGAAGAGCCAGGUGUGUUUUUCAGGAUGAACUAGACAAUGCUGUCACAAGUUUACCUCUACAUCUUAUUGCCUUGGAAAAAUUUCCUGCAUAUCGUGGCACAAGAUGGUUGGCUCUCCAGGCAGCAGUUGGCGUUGUGAAUCAGUCAUCUCAGCAUGUGUCUCCAAGAUCCCACAGCAGGGGGAAAAAGAGGUGGAGGGUCACAUGCCUGGUGUUACAUACUUUGAGGCAGAGGUGGUAGGUGCCAUUUCUGCUCACAGCUCAUGGACCAGAACAAAGCCAUGCAUACCUGAGAGAGGACCAGAAAAUAUUCUGAAGCAGAUGGCUAUUUGGUGAGCAGUAAAUGUUUCUGUUACAACAGGUCUUGACAAACUUCAAAUGUACUCCUACUAGGCCUACUUCACACCACUAAACUCUGUACUUCCUGUUGCUUGAUGGCAUCUUAUGCUGAUGUUUUCUAUCAUAGUGUCCGGCACAAAACAAGAGCUCAAUACAUAUACUUAAUAGCGCAUUUAGAUCUAAGAGUUUCACUUUAUCAAAAGAUUUUAGUACCUACGUAGCUAUUGGGCCACAUCAGGAAAAUGUAACUGCUUCUACAACUGCAAAGAAAAUUUAACUAAUUGUAUGCUCAUCCCAGCUUCAGGUUUUUGUUUUGUUUUGUUUGCUAGCUUCUUUUUAUUUCAUAAUUUUUGCUUUGUUUUCUGCCCUUGAGCAGAGGUUCAUUUCUAGUUUUCACUGGAAUUAGAACAACAGUUGUGUCCAUAUGCAAUAACAGUGUUUCAAAUUCUUUGGGGAUUUGCCCACAGUGUCUGCAGUCAUAUUGUGACACCAGUUGUGAUGCCAGUCUCUGUAAAUCAGACUUAUUCCCAGUGAGACAUUAUAUAUUUUUGCAGCCAAUACGAUCUAUUUUAUAGCGAUUUAUAGCAUUGUCUCUGAAAAGGAUACUUUGAUUUGUGUCUUGUUUUUGUCAGUUUUCAACACUUUGAUUGUGGCCCAGGUUAAUUAAUAUUUUGUGUCUAGGUUUCCUCAUCUCUAAAAUAAAGAUGUUUAUUUCUAUAGCUUCAUGUUGACAAUUAAAUUAUAUAAUUUAUGUUACUCAACUAGCAAGUAAAUUGAUGUACAGUGUAUUUAUAAAUGAUAGAUACUAUCUUUAUGUUAAUUUUUAUUAUUGUCAUCAUUAUCAUCAAUUUUCAGGUCCGUGUUCUGACUAAAAGGAAGCCACACUCUGUCGAAAACAAGCUUUGUAAGAAAAUUUUGAAGUAUUUACUUAUAUCUAACCAUUCAUUCCACCUUUUCUCCCAAAUAACACUCUAAUAUCUUGAGACAUCUUGUCUAGGGCCAGAUUUCAUAAAUGCUUGUGAGGCAGGAGAAUAAGUUCCAGAGGCAGUUCACACUGCCUAAAGCCAAUUCACACUGACUUCCUAUAACUAAAUCUAAAGGAAAAUCUCAACUUUCCUCGCCCAAGUAACAAAAGAAUCAGAGGUUAUACUCCCUUUGCAACCUGCCCCUUUUCUGCCUGGCAGAUGAAAAAUGAAAAGUACCUAUGACUGGUCCCCUCCCACGACCAGCCAGACUGGUCACGGAUCACUACUUCAUUUACAUAGGGCGUAAACCGAGUAACCAAUGGGAAACCUCUAGAGGGUAUUUAAACCCCAGAAAAUUCUGUAACCGGUGGUCUCCAGCAGGUUGCUCAAUCUUGCUGCCACUCUGUGGGAUGUACUUUUGUUUCAAUAAAUCUGUGCUCUUCCUUCAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications