v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) microRNA 3120 (ENSDNOG00000042549.1) URS000075DDE6_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCAUGUGACUGCCUGUCUGUGCCUGCUGUACAGGUGAGCGGAUGUUCUGCACAGCAAGUGUAGACAGGCAGACACAUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Artibeus jamaicensis microRNA aja-mir-3120 precursor
  2. Bos taurus microRNA bta-mir-3120 precursor
  3. Capra hircus microRNA 3120 (ENSCHIG00000000777.1)
  4. Homo sapiens microRNA hsa-mir-3120 precursor
  5. Pan troglodytes miRNA
  6. Pongo abelii miRNA
 Publications