Mus caroli (Ryukyu mouse) microRNA 341 (MGP_CAROLIEiJ_G0007255.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus caroli (Ryukyu mouse) microRNA 341 (MGP_CAROLIEiJ_G0007255.1) URS000075DD8F_10089

96 nucleotides
1 database (Ensembl)
Found in 4 other species
10 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAAAUGAUGAUGUCAGUUGGCCGGUCGGCCGAUCGCUCGGUCUGUCAGUCAGUCGGUCGGUCGAUCGGUCGGUCGGUCAGUCGGCUUCCUGUCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Mus musculus microRNA mmu-mir-341 precursor
Mus pahari microRNA 341 (MGP_PahariEiJ_G0007646.1)
Mus spretus (algerian mouse) microRNA 341 (MGP_SPRETEiJ_G0007600.1)
Rattus norvegicus microRNA rno-mir-341 precursor

Publications