v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-664b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-664b precursor URS000075DD29_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGGCUAAGGGAGAUGAUUGGGUAGAAAGUAUUAUUCUAUUCAUUUGCCUCCCAGCCUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla microRNA 664b (ENSGGOG00000041297.1)
  2. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 664b (ENSNLEG00000028517.1)
  3. Pongo abelii microRNA 664b (ENSPPYG00000031565.1)
 2D structure Publications