Mus pahari (Shrew mouse) microRNA 23b (MGP_PahariEiJ_G0006982.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus pahari (Shrew mouse) microRNA 23b (MGP_PahariEiJ_G0006982.1) URS000075D4CE_10093

74 nucleotides
1 database (Ensembl)
Found in 6 other species
122 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUGAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Cricetulus griseus (Chinese hamster) microRNA mir-23b (ENSCGRG00000021263.1, ENSCGRG00001001667.1)
Mesocricetus auratus (Golden Hamster) microRNA 23b (ENSMAUG00000005815.1)
Microtus ochrogaster (vole) microRNA 23b (ENSMOCG00000007964.1)
Mus caroli microRNA 23b (MGP_CAROLIEiJ_G0007338.1)
Mus musculus microRNA mmu-mir-23b precursor
Mus spretus (algerian mouse) microRNA 23b (MGP_SPRETEiJ_G0007692.1)

Publications