Canis lupus familiaris (dog) microRNA cfa-mir-381 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) microRNA cfa-mir-381 precursor URS000075D425_9615

75 nucleotides
2 databases (miRBase, RefSeq)
Found in 1 other species
28 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUAGAAUAUACAAGGGCAAGCUCUCUGUGAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Equus caballus (horse) microRNA eca-mir-381 precursor

2D structure

Publications