Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3180 precursor (hsa-mir-3180-1, hsa-mir-3180-3) URS000075D20A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3180-3: MIR3180-3 is a type of microRNA that is disrupted in an individual from Tibet, along with other microRNAs (mir517b, mir517a, mir517c) and their target genes (CD44, FAM115A) [PMC3938728]. In Alzheimer's disease (AD), differentially expressed long non-coding RNAs (lncRNAs) target protein-coding genes (PCGs) involved in AD- and aging-related biological functions [PMC7047416]. Specifically, MIR3180-3 and MIR3180-2 target PCGs involved in the neuroprotective role of THOP1 in AD and blood vessel remodeling [PMC7047416]. Additionally, MIR3180-2 and MIR3180-3 share co-expressed PCGs that are known to be AD-related [PMC7047416]. These findings suggest that MIR3180-3 may play a role in the pathogenesis of AD. In breast cancer, MIR3180-3 is identified as one of the miRNAs present in multiple breast cancer cell lines but absent in normal-like cell lines [PMC8261273]. In luminal-A breast cancer subtype, MIR3180-3 targets multiple genes including A4GALT, C10orf55, C2orf74, ZC4H2, ZNF512, ZNF655, ZNF71 HCG2042738 and HRCT1 [PMC8261273]. Furthermore, MIR3180-3 is observed in both luminal-A and triple-negative breast cancer subtypes [PMC8261273].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCGACGGGCGGAGCUUCCAGACGCUCCGCCCCACGUCGCAUGCGCCCCGGGAAAGCGUGGGGCGGAGCUUCCGGAGGCCCCGCCCUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications