v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1-1 (ENSNLEG00000025582.2) URS000075CF56_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Cebus imitator (Panamanian white-faced capuchin) microRNA 1-1 (ENSCCAG00000013068.1)
  2. Cercocebus atys miRNA (ENSCATG00000019754.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000013825.1)
  4. Gorilla gorilla gorilla microRNA 1-1 (ENSGGOG00000038412.1)
  5. Homo sapiens microRNA hsa-mir-1 precursor (hsa-mir-1-1)
  6. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000018169.1)
  7. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010874.1)
  8. Pan paniscus (bonobo) microRNA 1-1 (ENSPPAG00000021192.1)
  9. Pan troglodytes ptr-mir-1-1 (ENSPTRG00000027588.3)
  10. Pongo abelii miRNA
  11. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1 precursor (ppy-mir-1-1)
  12. Rhinopithecus bieti miRNA (ENSRBIG00000020215.1)
  13. Rhinopithecus roxellana miRNA (ENSRROG00000028114.1)
  14. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000006780.1)
 Publications