Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-4485 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-4485 precursor URS000075CEC3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4485: MIR4485 is a microRNA that is involved in the maturation process mediated by DGCR8 processing and recognition by METTL3 [PMC8426370]. METTL3 has been shown to promote the maturation of various miRNAs, including let-7e, miR221/222, MIR4485, miR25, miR93, miR126, and miR335 [PMC6588935]. Knockdown of METTL3 in T24 cells resulted in altered expression of several miRNAs, including let-7e, miR221/222, MIR4485, miR25, and miR93 [PMC6588935]. Additionally, METTL3 has been found to affect the internal m6A modification of lincRNA1281 and regulate mouse embryonic stem cell differentiation through a competing endogenous RNA (ceRNA) model [PMC6588935]. Previous studies have also identified MIR4485 as one of the main microRNAs modulated by METTL3 [PMC6588935]. The altered expression of MIR4485 and other microRNAs by METTL3 in T24 cells has been validated [PMC6588935]. In summary, MIR4485 is a microRNA that is involved in the maturation process mediated by DGCR8 processing and recognition by METTL3. Knockdown of METTL3 leads to altered expression of several microRNAs including MIR4485. Additionally,METTL3 affects m6A modification and regulates mouse embryonic stem cell differentiation through a ceRNA model. Previous studies have also identified MIR448 as one of the main microRNAs modulated by METTL3. The altered expression of MIR448 and other microRNAs has been validated in T24 cells.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGGCACCGCCUGCCCAGUGACAUGCGUUUAACGGCCGCGGUACCCUAACUGUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications