Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cebus imitator (Panamanian white-faced capuchin) microRNA 3074 (ENSCCAG00000020432.1) secondary structure diagram

Cebus imitator (Panamanian white-faced capuchin) microRNA 3074 (ENSCCAG00000020432.1) URS000075CA56_2715852

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCGACUCCUGUUCCUGCUGAACUGAGCCAGUGUGUAAAAUGAGAACUGAUAUCAGCUCAGUAGGCACCGGAGGGCGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

2D structure Publications