Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-888 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-888 precursor URS000075C9F0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR888: MIR888 is a microRNA located on Xq27.3 and is one of the nine genes mapped in this region. It has been described as a body fluid-specific microRNA, only detected in semen and epididymal tissue [PMC4254261]. In a patient cohort, there was an inverse correlation between the expression of MIR888 and MYCBP [PMC7762311]. The methylation status of the MIR888 promoter was monitored, as gene methylation is dysregulated in bladder cancer [PMC6615232]. E2F1 was found to upregulate miR-888 by accessing the hypomethylated promoter of MIR888, which is normally epigenetically silent [PMC6615232]. The expression of miR-888-5p is normally low and restricted to a few tissues, including testis, cerebellum, heart, and kidney [PMC6615232]. In urothelial bladder cancer (BC), MIR888 is hypomethylated compared to normal tissue [PMC6615232]. Knockdown of MIR888 in BC cells improved DNA double-strand break repair and reduced invasiveness by rescuing APLF levels [PMC6615232]. The expression pattern of MIR888 in normal human tissues is testis-specific [PMC6615232]. Treatment with 5-aza-2-deoxycytidine induced demethylation of the MIR888 CpG island [PMC6615232]. Hypomethylation renders the MIR888 promoter more accessible to its transcription factors [PMC6615232]. In various cancer types, including bladder cancer, upregulation of MIR888 promotes invasive tumor growth [PMC7226545].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCAGUGCUCUACUCAAAAAGCUGUCAGUCACUUAGAUUACAUGUGACUGACACCUCUUUGGGUGAAGGAAGGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications