Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4516 precursor URS000075C976_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4516: MIR4516 is a microRNA-coding gene that has been implicated in various diseases and biological processes. In a study on autism spectrum disorder (ASD), MIR4516 was identified as one of the candidate-susceptible miRNA-coding genes [PMC9906952]. In gastric cancer (GC), circRNA0047905 was found to bind MIR4516 and miR1227-5p, leading to the activation of the Akt/CREB signaling pathway and promoting disease progression [PMC8305186]. The levels of MIR4516 were found to be significantly associated with osteopaenia and osteoporosis in patients with low bone mineral density (BMD) who had experienced fractures [PMC5976644]. Furthermore, the levels of MIR4516 were decreased in plasma samples from osteoporotic patients compared to non-osteoporotic controls and osteopaenia patients [PMC5976644]. In a study on CD4 T cell latency, an increase in the levels of MIR4516 was observed upon treatment with CCL19 and IL-7, but inhibiting this microRNA did not reverse latency [PMC7926981]. Additionally, MIR4516 has been reported to be involved in regulating epithelial barrier function in intestinal and airway epithelium [PMC9128841]. The down-regulation of MIR4516 was observed along with other genes in various diseases such as autism spectrum disorder, multiple sclerosis, gastric cancer, and others [PMC8874170]. Overall, these findings highlight the potential role of MIR4516 as a biomarker or therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGAGAAGGGUCGGGGCAGGGAGGGCAGGGCAGGCUCUGGGGUGGGGGGUCUGUGAGUCAGCCACGGCUCUGCCCACGUCUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications