Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-2278 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-2278 precursor URS000075C899_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR2278: The only available information about MIR2278 and cancer is that its upregulation is associated with the inhibition of leukemic cell proliferation and enhanced apoptosis [PMC7277136]. Interestingly, our miRNA candidates MIR2278, miR27b-5p and miR29b-1-5p have never before been documented in pancreatic cancer, as far as we know [PMC7277136]. Our bioinformatic analysis of miRNA array data now predict that sulforaphane, SF102, and SF134 affect NF-κB signaling by the induction of MIR2278, which is involved in the regulation of many NF-κB target genes [PMC7277136]. The top candidate was MIR2278, because it was predicted to regulate the highest number of NF-κB-related target genes, followed by miR27b-5p and miR29b-1-5p, which partially overlapped in regulation of NF-κB-related target genes [PMC7277136]. By this method, we identified MIR2278 as common and most significantly downregulated miRNA following sulforaphane, SF102, and SF134 treatment (Table S1) [PMC7277136]. In a separate study, it was observed that MIR2278 was one of the most upregulated microRNAs [PMC4215582].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUGCAGGUGUUGGAGAGCAGUGUGUGUUGCCUGGGGACUGUGUGGACUGGUAUCACCCAGACAGCUUGCACUGACUCCAGACCCUGCCGUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications