Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-663b URS000075C3F6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-663b: Hsa-mir-663b is a microRNA that has been selected to confirm the impact of IL21 on gene expression [PMC4549109]. In a study, it was found that IL21 downregulates several miRNAs, including hsa-miR-7-2-3p, hsa-miR-7-5p, hsa-miR-1179, hsa-miR-130b-5p, hsa-miR-144-5p, and hsa-miR-328-3p [PMC6458921]. Conversely, IL21 upregulates miRNAs such as hsa-miR-767-5p and hsa-mir663b [PMC6458921]. Hsa-mir663b is a human microRNA that has been shown to be upregulated in response to IL21 [PMC6458921]. It is important to note that the specific role of this microRNA in gene expression modulation is not mentioned in the given context. However, it can be inferred that its upregulation may have an impact on gene expression patterns. In conclusion, the selection of hsa-mir663b as a target for investigation suggests its potential involvement in the modulation of gene expression by IL21. Further research is needed to elucidate the specific mechanisms and targets of this microRNA in order to fully understand its role in gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGGCCCGGCCGUGCCUGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-663b
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-663b
Publications