Gorilla gorilla gorilla (western lowland gorilla) mir-3150 microRNA precursor family

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (western lowland gorilla) mir-3150 microRNA precursor family URS000075C3A0_9595

80 nucleotides
1 database (Rfam)
Found in 1 other species
5 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGGAAGCAGGCCAACCUCGACGAUCUCCUCAGCACCUGAACGCCAAGGCUGGGGAGAUCCUCGAGGUUGGCCUGCUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens microRNA hsa-mir-3150a precursor

Publications