Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4252 precursor URS000075C378_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4252: Hsa-mir-4252 is a microRNA that is predicted to have a loss of miRNA-binding sites in a specific long non-coding RNA (lncRNA) due to the genetic variant rs10414043 [PMC8287568]. However, the expression of hsa-mir-4252 and other miRNAs could not be properly assayed, potentially leading to missed expression quantitative trait loci (eQTLs) for miRNAs that are expressed in different cell types [PMC9111935]. Further investigation into other immune cells and B-cell subsets may provide deeper insights into the impact of genetic risk variants [PMC9111935]. Hsa-mir-4252 is also associated with autophagy, as it targets autophagy-related genes such as MAP1LC3C [PMC8589263]. In patients with obesity, hsa-mir-4252 is downregulated and regulates the expression of several genes associated with obesity [PMC6102639]. Increased expression of MAP1LC3C (hsa-mir-4252) indicates autophagosome accumulation, but its absence in differential expression at baseline may be related to autophagosome clearance [PMC9781133]. In gene-miRNA interactions, hsa-mir-4252 is one of several microRNAs identified as regulatory genes [PMC10141791].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGGGGCUGGCAGCUCAUCAGUCCAGGCCAUCUGGCCACUGAGUCAGCACCAGCGCCCAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications