v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HOXD cluster antisense RNA 2 (HOXD-AS2) URS000075C24F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HOXD-AS2: HOXD-AS2 is a long non-coding RNA (lncRNA) that has been found to play a role in gastric cancer (GC) and gliomas [PMC7667460]. In GC cells, it has been shown that HOXD-AS2 may modulate the expression of HOXD8 and activate the PI3K/Akt signaling pathway [PMC7667460]. Low expression of HOXD-AS2 has been associated with lymph node metastasis and TNM stage in GC [PMC7667460]. In gliomas, HOXD-AS2 is upregulated and its expression positively correlates with glioma grades [PMC7992894][PMC8865078][PMC8810070]. Patients with high levels of HOXD-AS2 in glioblastoma (GBM) experience shorter overall survival times [PMC7992894][PMC8865078][PMC8810070]. The binding between KSRP and the 3' end of HOXD-AS2 has been predicted using catRAPID [PMC7992894]. In addition to GC and gliomas, other lncRNAs such as H19, LINC00635, LINC00277, RP11-196G11.2, LINC00152, MALAT1, and LOC100506207 have also been found to be differentially regulated in glioma cells [PMC8865078]. The expression levels of H19, HOXD-AS2, and miR-198 have been detected in clinical glioma samples [PMC7992894]. Furthermore, overexpression of HOXD-AS2 has been shown to promote cell migration and invasion ability in U87 and LN299 cells [PMC8810070].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGAAAUGUAGGGGAGCAGCCGGACUGAGCUGCCCAAGGGGGUCGGCGCCCCAGGCUUCUUGGUGGCAUGCUGGGGAGCGGGGAGGGGGCGAUUCUUACCCGAAGGCUGCCGAGCUACAGGCGGCGGUCGGUCCGGGCGUCUGCUGUAAUCCACUAGGCGCUGCCCGGCUGCGCUCACUCUCGGACGCAGAGACCCGCUCAUGUUGGUGAAGAAGCCGCGCCAGAACCGCGCGGCUGCAGUCACCUCGAGCAGGCCGGCUGCUCCUGGCAGGCGGUGUCGGCGCCGGCGGGGGACUCGGCGCCCAGGGCCCCUUCCAGGCCCUCCCUCGCCGGGCUCCCCACCAGCUCCGGAGGUGGCGGCGAUGCGGACCGAGUGAGCGGCGGUGGGGCCAGGCCGGGCGCCGGGCGGGAGCCGAGGCCGCGGCGGACUCCGCAAUCCCGCAGCCGGUGACUGGAGCCCACCUCUGCAGAGACAAAGGAACUGCUCUGGUGAACUCCCCCUGAAAGUAAAUGUCCUUGGCUGGCCUCCAGCAUUCCCCUCAUGGGCAUAGCCAUGCAGCCUUCAGAACCUUCCUGAAAGAGAUGCCCAAGGAUUCAGCAAACACGGGGGAAGCAGAGGACACAAGAAGCUUGGAUGUGAAAUAGCACUUCCUUCUGUGUUACAGAAUAAAACAAUAUUUUAAAUUACACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications