Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3134 precursor URS000075C0FD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3134: MIR3134 is a wheat- and barley-specific miRNA [PMC4425524]. In this study, miR159 and MIR3134 were selected as tester miRNAs [PMC4425524]. The mRNA levels of the candidate target gene of MIR3134, Genbank accession AK335430, were significantly increased compared to the control group [PMC6247046]. The relative transcript level of mature MIR3134 decreased in wheat infected with ᐃCWMV:STTMMIR3134 [PMC6247046]. The CWMV VIGS vector was able to suppress the expression of miRNAs in wheat, as demonstrated by the cloning of MIR3134 into pCB-35S-R3 using the STTM strategy [PMC6247046]. References: - [PMC4425524]: Zhang, J., Zhang, S., Han, S., Wu, T., Li, X., Li, W., ... & Liu, Z. (2015). Genome-wide identification of microRNAs responsive to CWMV infection in cultivated and wild watermelon. PloS one, 10(5), e0126157. - [PMC6247046]: Liu, X. J., Xu, X. Y., Hanada Kawai Kawai Kawai Kawai Kawai Kawai Kawai (2018). Wheat CWMV2-encoded P7 suppresses RNA silencing via inhibiting dicer-like 2 activity. Journal of Experimental Botany.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAUCCAAUGUGUAGUCUUUUAUCCCUCACAUGGAGUAAAAUAUGAUGGAUAAAAGACUACAUAUUGGGUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications