Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 3134 (ENSGGOG00000039300.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 3134 (ENSGGOG00000039300.1) URS000075C0FD_9595

74 nucleotides
1 database (Ensembl)
Found in 5 other species
4 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGUAUCCAAUGUGUAGUCUUUUAUCCCUCACAUGGAGUAAAAUAUGAUGGAUAAAAGACUACAUAUUGGGUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Homo sapiens microRNA hsa-mir-3134 precursor
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3134 (ENSNLEG00000021026.2)
Pan paniscus (bonobo) microRNA 3134 (ENSPPAG00000021224.1)
Pan troglodytes microRNA 3134 (ENSPTRG00000042038.2)
Pongo abelii microRNA 3134 (ENSPPYG00000033205.1)

Publications