Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3917 (ENSNLEG00000026495.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3917 (ENSNLEG00000026495.2) URS000075BB4E_61853

93 nucleotides
1 database (Ensembl)
Found in 3 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCGCUUUUGUGCGCGCCCGGGUCUGUUGGUGCUCAGAGUGUGGUCAGGCGGCUCGGACUGAGCAGGUGGGUGCGGGGCUCGGAGGAGGCGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Homo sapiens microRNA hsa-mir-3917 precursor
Pan paniscus (bonobo) microRNA 3917 (ENSPPAG00000021345.1)
Pan troglodytes microRNA 3917 (ENSPTRG00000039285.2)

Publications