Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548ac precursor URS000075BB42_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR548AC: MIR548AC is a microRNA (miRNA) that has limited research on its role in immunological conditions [PMC10061723]. The presence of MIR548AC within the first intron of CD58 and the strong linkage between rs10801908 and rs1414273 might provide an incomplete picture of its effect [PMC10061723]. A study identified six candidate miR-SNPs, including MIR548AC, in the precursor, loop, and seed regions of four miRNAs [PMC10061723]. The study found that rs1414273 (MIR548AC) affects the transcription of CD58 and MIR548AC [PMC10061723]. This SNP is potentially associated with multiple sclerosis (MS) susceptibility and changes in MIR548AC stability [PMC10061723]. However, further prioritization of microRNA SNPs was not done due to a lack of predicted structural changes or high linkage disequilibrium in the major histocompatibility complex locus [PMC10061723]. The risk allele for rs1414273 is expected to result in higher levels of MIR548AC [PMC10061723]. Among other prioritized SNPs, rs1414273 (MIR548AC) was identified as a candidate MS SNP [PMC10061723]. Another SNP, rs2648841, was not among the prioritized effects outlined by the International Multiple Sclerosis Genetics Consortium (IMSGC) for MS susceptibility [PMC10061723]. Overall, this study highlights rs1414273 (MIR548AC) as a potential candidate MS SNP among other candidates identified through prioritization processes [PMC10061723].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAUUAGGUUGGUGCAAAAGUUAUUGUGGUUUUUGCUAUUUUUUUUUAAUGGCAAAAACCGGCAAUUACUUUUGCACUAACCUAGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications