Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548d precursor (hsa-mir-548d-1) URS000075B920_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR548D1: MIR548D1 is a non-coding RNA gene that produces two mature microRNAs, miR-548d-5p and miR-548d-3p, which target JunD [PMC6959298]. The MIR548D1 promoter luciferase reporter plasmid was constructed by cloning a 1000 bp fragment before the transcription starting site into the pEZX-FR01 plasmid [PMC6959298]. The study aimed to investigate the involvement of FOXD3 and BRD4 in the transcription of MIR548D1, and a luciferase reporter containing its promoter region was generated [PMC6959298]. The study found that FOXD3 is a putative transcription factor for MIR548D1 gene, as predicted by several transcription regulation databases [PMC6959298]. Additionally, bioinformatics analysis of The Cancer Genome Atlas (TCGA) revealed that MIR548D1 is uniquely upregulated in the basal-like subtype of breast cancer compared to other subtypes [PMC6959298]. Furthermore, both mature products of MIR548D1 have putative binding sites on the 3′UTR region of JUND [PMC6959298]. The study also showed that BRD4/FOXD3 was enriched in the promoter region of MIR548D1 through luciferase and sequential ChIP assays [PMC6959298]. Interestingly, FOXD3 expression is also highly expressed in basal-like breast cancer based on TCGA analysis, similar to MIR548D1 expression [PMC6959298]. Finally, among the top 20 upregulated differentially expressed genes (DEGs), eight genes were identified as newly androgen receptor (AR)-regulated genes including CYP4F8 and MIR548D1 [PMC9107748].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAAGUUAUAUUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCUGUAAAAGUAAUGGCAAAAACCACAGUUUCUUUUGCACCAGACUAAUAAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications