v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-338-P2_3p (mature (guide)) URS000075B45F_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCAGCAUCAGUGAUUUUGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-338-P2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-338-P2_3p (mature (guide))
  3. Bos taurus bta-miR-338
  4. Canis lupus familiaris cfa-miR-338
  5. Cavia porcellus cpo-miR-338-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-338-P2_3p (mature (co-guide))
  7. Chrysemys picta cpi-miR-338a-3p
  8. Columba livia cli-miR-338b-3p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-338
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-338-3p
  11. Gallus gallus gga-miR-338-3p
  12. Gekko japonicus Gja-Mir-338-P2_3p (mature (guide))
  13. Gorilla gorilla gorilla ggo-miR-338 (MIR338)
  14. Gorilla gorilla (western gorilla) ggo-miR-338
  15. Homo sapiens Hsa-Mir-338-P2_3p (mature (guide))
  16. Macaca mulatta Mml-Mir-338-P2_3p (mature (guide))
  17. Monodelphis domestica mdo-miR-338
  18. Mus musculus Mmu-Mir-338-P2_3p (mature (guide))
  19. Ophiophagus hannah oha-miR-338-3p
  20. Ornithorhynchus anatinus Oan-Mir-338-P2_3p (mature (guide))
  21. Pteropus alecto (black flying fox) pal-miR-338-3p
  22. Python bivittatus pbv-miR-338-3p
  23. Rattus norvegicus (Norway rat) rno-miR-338-3p
  24. Sarcophilus harrisii Sha-Mir-338-P2_3p (mature (guide))
  25. Sphenodon punctatus (tuatara) Spt-Mir-338-P2_3p (mature (guide))
  26. Taeniopygia guttata (zebra finch) Tgu-Mir-338-P2_3p (mature (co-guide))
  27. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3261208