Tetraodon nigroviridis (spotted green pufferfish) tni-miR-182

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tetraodon nigroviridis (spotted green pufferfish) tni-miR-182 URS000075B447_99883

21 nucleotides
1 database (miRBase)
Found in 12 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGGUUCUAGACUUGCCAACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Cavia porcellus cpo-miR-182-3p
Chrysemys picta cpi-miR-182-3p
Danio rerio dre-miR-182-3p
Dasypus novemcinctus (nine-banded armadillo) dno-miR-182-3p
Gadus morhua gmo-miR-182-3p
Homo sapiens hsa-miR-182-3p
Ophiophagus hannah oha-miR-182-3p
Oryctolagus cuniculus (rabbit) ocu-miR-182-3p
Paralichthys olivaceus pol-miR-182-3p
Pteropus alecto (black flying fox) pal-miR-182-3p
Takifugu rubripes fru-miR-182
Xenopus tropicalis xtr-miR-182-3p