Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-182-3p URS000075B447_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUUCUAGACUUGCCAACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cavia porcellus cpo-miR-182-3p
  2. Chrysemys picta cpi-miR-182-3p
  3. Danio rerio dre-miR-182-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-182-3p
  5. Gadus morhua gmo-miR-182-3p
  6. Homo sapiens hsa-miR-182-3p
  7. Ophiophagus hannah oha-miR-182-3p
  8. Paralichthys olivaceus pol-miR-182-3p
  9. Pteropus alecto (black flying fox) pal-miR-182-3p
  10. Takifugu rubripes fru-miR-182
  11. Tetraodon nigroviridis tni-miR-182
  12. Xenopus tropicalis xtr-miR-182-3p
Publications