Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4476 URS000075B0F6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4476: Hsa-mir-4476 is a microRNA that has been studied in various contexts. Lentiviral particles carrying the hsa-mir-4476 precursor vector were used to overexpress miR-4476 in U87 cells, as confirmed by qPCR [PMC7181615]. Hsa-mir-4476 is one of the three miRNAs, along with hsa-miR-371a-5p and hsa-miR-345-3p, that were selected to create a miRNA-mRNA network [PMC8872348]. Hsa-mir-4476 has been identified as one of the miRNAs associated with ANP, BNP, TNNT2, TNNI3, α-Actinin, MYH-7 in relation to a specific condition [PMC3842578]. In another study, hsa-mir-4476 was included in a panel of eight miRNAs that showed promising results [PMC5223017]. Hsa-mir-4476 was found to be regulated by the hub DEC hsa_circ_0101125 and its specific functions in osteoarthritis have not been investigated yet [PMC9869167]. It has been identified as having a binding site along with hsa-miR5055p [PMC8558378]. Although its role is not well understood and it lacks validation, hsa-mir-4476 is coexpressed by PAX5 and appears to be involved in an incoherent feed-forward loop regulatory motif that affects shear stress response. Further studies are needed to elucidate its possible involvement [PMC6176299].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGAAGGAUUUAGGGACAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications