Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-219a precursor (hsa-mir-219a-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-219a precursor (hsa-mir-219a-2) URS000075B0B0_9606

Automated summary: This pre miRNA sequence is 97 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (GeneCards, MalaCards, miRBase, RefSeq, Ensembl, HGNC, ENA). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-219, RF00251). Homo sapiens (human) microRNA hsa-mir-219a precursor (hsa-mir-219a-2) sequence is a product of MIR219A2, mir-219a-2, mir-219a-2 precursor, hsa-mir-219a-2 precursor, mir-219a-2 precurso, ENSG00000284185.1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACUCAGGGGCUUCGCCACUGAUUGUCCAAACGCAAUUCUUGUACGAGUCUGCGGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGCUGAGCUCCGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Cercocebus atys miRNA (ENSCATG00000043195.1)
    2. Chlorocebus sabaeus (African green monkey) miRNA MIR219A2 (ENSCSAG00000020154.1)
    3. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000017178.1)
    4. Delphinapterus leucas microRNA 219a-2 (ENSDLEG00000013180.1)
    5. Equus asinus asinus (donkey) miRNA (ENSEASG00005016200.1)
    6. Equus caballus (horse) microRNA eca-mir-219 precursor (eca-mir-219-2)
    7. Erinaceus europaeus (western European hedgehog) microRNA 219a-2 (ENSEEUG00000016154.1)
    8. Gorilla gorilla gorilla microRNA 219a-2 (ENSGGOG00000033097.2)
    9. Macaca fascicularis microRNA 219a-2 (ENSMFAG00000018189.2)
    10. Macaca mulatta (Rhesus monkey) microRNA mml-mir-219 precursor (mml-mir-219-2)
    11. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000007311.1)
    12. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000020285.1)
    13. Monodon monoceros microRNA 219a-2 (ENSMMNG00015011927.1)
    14. Myotis lucifugus (little brown bat) microRNA 219a-2 (ENSMLUG00000017921.1)
    15. Nomascus leucogenys miRNA (ENSNLEG00000019722.2)
    16. Pan paniscus (bonobo) miRNA (ENSPPAG00000000194.1)
    17. Pan troglodytes ptr-mir-219-2 (ENSPTRG00000027616.2, ENSPTRG00000051981.1)
    18. Papio anubis (olive baboon) miRNA (ENSPANG00000027119.3)
    19. Phocoena sinus miRNA (ENSPSNG00000017587.1)
    20. Physeter catodon microRNA 219a-2 (ENSPCTG00005015174.1)
    21. Piliocolobus tephrosceles microRNA 219a-2 (ENSPTEG00000011720.1)
    22. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021133.2)
    23. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-219 precursor (ppy-mir-219-2)
    24. Pteropus vampyrus (large flying fox) microRNA 219a-2 (ENSPVAG00000026552.1)
    25. Rhinolophus ferrumequinum microRNA 219a-2 (ENSRFEG00010018287.1)
    26. Rhinopithecus bieti miRNA (ENSRBIG00000015003.1)
    27. Rhinopithecus roxellana miRNA (ENSRROG00000009783.1)
    28. Sus scrofa microRNA mir-219b (multiple genes)
    29. Theropithecus gelada microRNA 219a-2 (ENSTGEG00000019604.1)
    2D structure Publications New