Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sus scrofa (pig) microRNA 219a-2 (multiple genes) secondary structure diagram

Sus scrofa (pig) microRNA 219a-2 (multiple genes) URS000075B0B0_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCAGGGGCUUCGCCACUGAUUGUCCAAACGCAAUUCUUGUACGAGUCUGCGGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGCUGAGCUCCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Cercocebus atys microRNA 219a-2 (ENSCATG00000043195.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 219a-2 (ENSCSAG00000020154.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000017178.1)
  4. Delphinapterus leucas microRNA 219a-2 (ENSDLEG00000013180.1)
  5. Equus asinus asinus microRNA 219a-2 (ENSEASG00005016200.1)
  6. Equus asinus (ass) microRNA 219a-2 (ENSEASG00005016200.2)
  7. Equus caballus (horse) microRNA eca-mir-219 precursor (eca-mir-219-2)
  8. Erinaceus europaeus (western European hedgehog) microRNA 219a-2 (ENSEEUG00000016154.1)
  9. Gorilla gorilla gorilla microRNA 219a-2 (ENSGGOG00000033097.2)
  10. Homo sapiens microRNA hsa-mir-219a precursor (hsa-mir-219a-2)
  11. Macaca fascicularis microRNA 219a-2 (ENSMFAG00000018189.2)
  12. Macaca mulatta microRNA mml-mir-219 precursor (mml-mir-219-2)
  13. Macaca nemestrina (Pig-tailed macaque) microRNA 219a-2 (ENSMNEG00000007311.1)
  14. Mandrillus leucophaeus (Drill) microRNA 219a-2 (ENSMLEG00000020285.1)
  15. Monodon monoceros (narwhal) microRNA 219a-2 (ENSMMNG00015011927.1)
  16. Myotis lucifugus microRNA 219a-2 (ENSMLUG00000017921.1)
  17. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 219a-2 (ENSNLEG00000019722.2)
  18. Pan paniscus (bonobo) microRNA 219a-2 (ENSPPAG00000000194.1)
  19. Pan troglodytes ptr-mir-219-2 (ENSPTRG00000027616.2, ENSPTRG00000051981.1)
  20. Papio anubis microRNA 219a-2 (ENSPANG00000027119.3)
  21. Phocoena sinus microRNA 219a-2 (ENSPSNG00000017587.1)
  22. Physeter catodon (sperm whale) microRNA 219a-2 (ENSPCTG00005015174.1)
  23. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 219a-2 (ENSPTEG00000011720.1)
  24. Pongo abelii microRNA 219a-2 (ENSPPYG00000021133.2)
  25. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-219 precursor (ppy-mir-219-2)
  26. Pteropus vampyrus (large flying fox) microRNA 219a-2 (ENSPVAG00000026552.1)
  27. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 219a-2 (ENSRFEG00010018287.1)
  28. Rhinopithecus bieti microRNA 219a-2 (ENSRBIG00000015003.1)
  29. Rhinopithecus roxellana miRNA (ENSRROG00000009783.1)
  30. Theropithecus gelada (gelada) microRNA 219a-2 (ENSTGEG00000019604.1)
2D structure Publications