Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4779 precursor URS000075AE20_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4779: MIR4779 is a microRNA that directly targets PAK2 expression, along with other microRNAs such as miR-7-5p and miR455-3p [PMC10017488]. A study analyzing the regulation of target genes for four overexpressed microRNAs in NR (MIR4278, MIR4422, MIR4779, MIR1268B) found a total of 411 interactions [PMC8138064]. Among these interactions, 16 genes were identified to be potentially regulated by MIR4278, MIR4422, and MIR4779 [PMC8138064]. Additionally, four microRNAs (MIR4278, MIR4422, MIR4779, and MIR1268B) and one snoRNA (SNORA12) with aberrant expression associated with cancer pathogenesis were identified [PMC8138064]. The tumor suppressor role of the miRNAs MIR4278, MIR4422, and MIR4779 has been reported in inducing apoptosis and cell cycle arrest as well as overall cancer survival [PMC8138064]. Furthermore, seven miRNAs (miR1297, miR4465, miR26a/b. miR4779. miR4778. miR345. and miR203) were found to be expressed at low levels in tumor tissues or cells [PMC7797122].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAUGUCUUACUGCUUUUACUGUUCCCUCCUAGAGUCCAUUCUUUACUCUAGGAGGGAAUAGUAAAAGCAGUAAGACAUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications